View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4410_high_25 (Length: 246)

Name: NF4410_high_25
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4410_high_25
NF4410_high_25
[»] chr2 (2 HSPs)
chr2 (19-235)||(21435520-21435736)
chr2 (165-215)||(27154219-27154269)


Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 21435736 - 21435520
Alignment:
19 ccattgattcaactgttgttgactgtttgaatattgtgtagcgcatacgttttagtttgaaggcgtgtccgatgtccatgttagatattcctgtctatca 118  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21435736 ccattgattcaactgttgttgactgtttgaatattgtgtaccgcatacgttttagtttgaaggcgtgtccgatgtccatgttagatattcctgtctatca 21435637  T
119 ctgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaaccaatagaataatcaaaatctttca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | ||||||||||    
21435636 ctgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaaccaatagaatacgccaaatctttca 21435537  T
219 ctcattaaactcttcat 235  Q
    |||||||||||||||||    
21435536 ctcattaaactcttcat 21435520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 27154269 - 27154219
Alignment:
165 actataattgaagtacttagttgacgaaaccaatagaataatcaaaatctt 215  Q
    ||||||||||||||| |||| ||| |||| ||||||||||| |||||||||    
27154269 actataattgaagtaattaggtgaggaaagcaatagaataagcaaaatctt 27154219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4272 times since January 2019
Visitors: 8757