View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_high_28 (Length: 238)
Name: NF4410_high_28
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_high_28 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2302909 - 2303129
Alignment:
Q |
1 |
taaattgtggagtttcttcaatgccactactctaccactaggtagatttgctttataaacactaccatagccaccaactcctatgcaatatttgatgtca |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
2302909 |
taaattgtggagtttcttcaatgccactactctaccactaggtagatttgctttataaacactaccataaccaccaacgcctatgcaatatttgatgtca |
2303008 |
T |
|
Q |
101 |
aaattctctgttgcttcaattatatcttcataagcaattttaccatcatagttccatattgnnnnnnngtcaccattcttcgtagtttgtgttcttgaaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
2303009 |
aaattctctgttgcttcaattatatcttcataagcaattttaccatcatagttccatattgaaaaaaagtcaccattcttcgtagtttgtgttcttgaaa |
2303108 |
T |
|
Q |
201 |
tgaaactacaagccttacacc |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
2303109 |
tgaaactacaagccttacacc |
2303129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2331 times since January 2019
Visitors: 8690