View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_high_29 (Length: 235)
Name: NF4410_high_29
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 31526194 - 31525961
Alignment:
| Q |
1 |
aagtttaatgttatgcaattgttttgaattaaaaaagtttggtgatatatgtgactctgaaaaagtggatgcatgacatgtttgcgatgtgaggaacact |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31526194 |
aagtttaatgttatgtaattgttttgaattaaaaaagtttggtgatatatgtgactctgaaaaagtggatgcatgacatgtttgcgatgtgaggaacact |
31526095 |
T |
|
| Q |
101 |
tatttggtcaatgagatt--------------acattcctaaatacacaaaatgaattaagaacaagctacaattgaataaaatgaagtagcacgtttgc |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31526094 |
tatttggtcaatgagattgaattatttcaataacattcctaaatacacaaaatgaattaagaacaagctacaattgaataaaatgaagtagcacgtttgc |
31525995 |
T |
|
| Q |
187 |
attcaaaagtactaaacaaattacatggttcaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31525994 |
attcaaaagtactaaacaaattacatggttcaag |
31525961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 15175745 - 15175707
Alignment:
| Q |
183 |
ttgcattcaaaagtactaaacaaattacatggttcaagt |
221 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
15175745 |
ttgcattcaaaagtactcaacatattacatggttcaagt |
15175707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2417 times since January 2019
Visitors: 8707