View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4410_high_33 (Length: 219)

Name: NF4410_high_33
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4410_high_33
NF4410_high_33
[»] chr3 (1 HSPs)
chr3 (1-219)||(53699489-53699707)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 53699707 - 53699489
Alignment:
1 aaattagtttgtgggagtagcaacaccatatacgtgaaattagttttgcaaacatgtttagtaacaatacttgcatgcaaagttttgctgttaccgttaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
53699707 aaattagtttgtgggagtagcaacaccatatacgtgaaattagttttgcaaacatgtttagtaacaatacttgcatgcaaagttttgctgttactgttaa 53699608  T
101 gaggacctttcaagtattcagtttgtttagaattaaaatgaacttagatttcatataacaaacatcttgggttttaattcaaatatatatggctaaattt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
53699607 gaggacctttcaagtattcagtttgtttagaattaaaatgaacttagattgcatataacaaacatcttgggttttaattcaaatatatatggctaaattt 53699508  T
201 accactactattcttttct 219  Q
    |||||||||||||||||||    
53699507 accactactattcttttct 53699489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3803 times since January 2019
Visitors: 8728