View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_20 (Length: 270)
Name: NF4410_low_20
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_20 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 39737007 - 39736864
Alignment:
Q |
1 |
ggtaataattatgacaaatcatatactgcatttttataatgacaatannnnnnnnnnnngagaaaacaaaacaaaagttcatcactaaataaattccaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| || |||||||||||||||||||||||| |
|
|
T |
39737007 |
ggtaataattatgacaaatcatatactgcatttttataatgaccatatttttattttttgagaaaacaaaataa--gttcatcactaaataaattccaag |
39736910 |
T |
|
Q |
101 |
cacaagatgtgttcacaaacgcaaaagtacatatcagcgtcccacc |
146 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39736909 |
cacaagatgtgttcacaaacgcaaaagtacatatcagcgtcccacc |
39736864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 218 - 252
Target Start/End: Complemental strand, 39736783 - 39736749
Alignment:
Q |
218 |
tgagaccaagaacaataaatcaaaaaagggtaagg |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
39736783 |
tgagaccaagaacaataaatcaaaaaagggtaagg |
39736749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2664 times since January 2019
Visitors: 8577