View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_21 (Length: 259)
Name: NF4410_low_21
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_21 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 39300767 - 39300997
Alignment:
Q |
18 |
agaaagaggtacactgcagatcaatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatcttcctttt |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
39300767 |
agaaagaggtacactgcagatcaatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatcttcgtttt |
39300866 |
T |
|
Q |
118 |
gttgtgggttatttttgaacaattatatttagactgtcattcattcaaatctcaagtttgaatctttagagtgtcaatgannnnnnnnnattttgtgtgg |
217 |
Q |
|
|
||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
39300867 |
gttgtggcttatttttgaacaattatatttagagtgtgattcattcaaatctcaagtttgaatctttagagtgtccctga-ttttttttattttgtgtgg |
39300965 |
T |
|
Q |
218 |
actaatccatacataattttgttttgcctttg |
249 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
39300966 |
actaatccatacataattttgttttgcctttg |
39300997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3849 times since January 2019
Visitors: 8728