View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_24 (Length: 254)
Name: NF4410_low_24
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_24 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 52035945 - 52036167
Alignment:
Q |
18 |
accactcaatagattacattaaccattatttaaccgttttctgtgggaacaggggatgcctcaacattaggcaaggcaactactgttgttagtctgtttg |
117 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
52035945 |
accactcaatagattacattaaccatt---taaccgttttctgtgggaacaggggatgcctcaacataaggcaaggcaactactgttgttagtctgtttg |
52036041 |
T |
|
Q |
118 |
agattctatacagcaagtaaacaataattgcgaatgctaattaagttcacaacaacgagcaattgcatttattccatttaataagaatctctattggtgt |
217 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52036042 |
agattctatacaacaagtaaacaataattgcgaatgctaattaagttcacaacaacgaccaattgcatttattccatttaataagaatctctattggtgt |
52036141 |
T |
|
Q |
218 |
tgcacaaattcactatacacaggttc |
243 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
52036142 |
tgcacaaattcactatacacaggttc |
52036167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2990 times since January 2019
Visitors: 8641