View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_29 (Length: 250)
Name: NF4410_low_29
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_29 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 32325909 - 32325678
Alignment:
Q |
1 |
tcacttcaatttttcatttcactcttttaaacctaaagtattttgcttttcacgtcgttttaactttaatgacgtgnnnnnnnntacataannnnnnn-- |
98 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
32325909 |
tcacttcaatttttcatttcactcttttaaacctaaagtattttgcttttcacgtcgttttaactttaatgacgtgaaaaaaaatacataatattttttt |
32325810 |
T |
|
Q |
99 |
--ggattctttgatgtctcggcaacctctcaaggagttgagatatactactgtcaataggtattatattgtggtaagagatggtgaagagacatcataga |
196 |
Q |
|
|
| ||| ||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
32325809 |
ttgtattatttgatgtctcggcaacctctcaaggagtcgagatatactgctgtcaatcggtattatattgcggtaagagagggtgaagagacatcataga |
32325710 |
T |
|
Q |
197 |
tannnnnnnctttctccttttaccccttttaa |
228 |
Q |
|
|
|| ||||||||||||||||||||||| |
|
|
T |
32325709 |
tatttttttctttctccttttaccccttttaa |
32325678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3405 times since January 2019
Visitors: 8687