View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_3 (Length: 496)
Name: NF4410_low_3
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_3 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 446; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 5 - 482
Target Start/End: Complemental strand, 21483248 - 21482771
Alignment:
Q |
5 |
taaccatcatcagaatattcaaggttctgatccacttgcgagattaggtagtggtgataattgcaccaatgttgctgctggtggttctcatgcaaatcca |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21483248 |
taaccatcatcagaatattcaaggttctgatccacttgcgagattaggtagtggtgatagttgcaccaatgttgctgctggtggttctcatgcaaatcca |
21483149 |
T |
|
Q |
105 |
gcgaactggatgtattggcagactatgaccggtgggacagcagcttccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgacc |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21483148 |
gcgaactggatgtattggcagactatgaccggtgggacagcagcctccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgacc |
21483049 |
T |
|
Q |
205 |
gccccaccatgcagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttaagctgtatattattgttagatcatatgt |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||| |
|
|
T |
21483048 |
gccccaccatgcagacacagagttctcaccagggtcgaagtgcatccgataggagacaggtttgtggacttcagctttatattattgttagattatatgt |
21482949 |
T |
|
Q |
305 |
tttggttgtttatatgatctacgatgtgtgattattagaaatgcatgttaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaa |
404 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21482948 |
tttggttgtttatatgatctacgatgtgtgattattagaaatgcatgtaaatgcaaaatcatttgttattgaacttgaataagttttaaattatggtcaa |
21482849 |
T |
|
Q |
405 |
caaccgtaattgtggctgcaatataatggctttaaaggtctctgcaacggcatagcaaccacagttgtggtggtattt |
482 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
21482848 |
caaccgtaattgtggctgcaatataatggttttaaaggtctctgcaacggcgtagcaaccacagttgtggtggtattt |
21482771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 386 - 430
Target Start/End: Complemental strand, 21490796 - 21490752
Alignment:
Q |
386 |
agttttaaattatggtcaacaaccgtaattgtggctgcaatataa |
430 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||| |
|
|
T |
21490796 |
agttttaaattttggtctgcaaccgtaattgtggctgcgatataa |
21490752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3393 times since January 2019
Visitors: 8687