View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4410_low_30 (Length: 247)

Name: NF4410_low_30
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4410_low_30
NF4410_low_30
[»] chr7 (1 HSPs)
chr7 (14-177)||(43516180-43516343)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 14 - 177
Target Start/End: Complemental strand, 43516343 - 43516180
Alignment:
14 ctgtgtatcttcaccataattgaatagactaatccctcaaacggttagaattgcaatgtgtgacaaagctcactcacaaaatatttgattggtgttagat 113  Q
    |||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43516343 ctgtgtatcttcaccacaattgaatagactaatccatcgaacggttagaattgcaatgtgtaacaaagctcactcacaaaatatttgattggtgttagat 43516244  T
114 ttgaaccatgacttccgattaagttgcaagagtttgagtcaataaaagggtgcatggaaggttt 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
43516243 ttgaaccatgacttccgattaagttgcaagagtttgagtcaataaaagggtgcatgcaaggttt 43516180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3833 times since January 2019
Visitors: 8728