View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_32 (Length: 246)
Name: NF4410_low_32
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 21435736 - 21435520
Alignment:
| Q |
19 |
ccattgattcaactgttgttgactgtttgaatattgtgtagcgcatacgttttagtttgaaggcgtgtccgatgtccatgttagatattcctgtctatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435736 |
ccattgattcaactgttgttgactgtttgaatattgtgtaccgcatacgttttagtttgaaggcgtgtccgatgtccatgttagatattcctgtctatca |
21435637 |
T |
|
| Q |
119 |
ctgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaaccaatagaataatcaaaatctttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
21435636 |
ctgtttcatcaactgttacttaaatgcaatatgtttaacacctgatactataattgaagtacttagttgacgaaaccaatagaatacgccaaatctttca |
21435537 |
T |
|
| Q |
219 |
ctcattaaactcttcat |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21435536 |
ctcattaaactcttcat |
21435520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 27154269 - 27154219
Alignment:
| Q |
165 |
actataattgaagtacttagttgacgaaaccaatagaataatcaaaatctt |
215 |
Q |
| |
|
||||||||||||||| |||| ||| |||| ||||||||||| ||||||||| |
|
|
| T |
27154269 |
actataattgaagtaattaggtgaggaaagcaatagaataagcaaaatctt |
27154219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3626 times since January 2019
Visitors: 8709