View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_40 (Length: 219)
Name: NF4410_low_40
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_low_40 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 53699707 - 53699489
Alignment:
| Q |
1 |
aaattagtttgtgggagtagcaacaccatatacgtgaaattagttttgcaaacatgtttagtaacaatacttgcatgcaaagttttgctgttaccgttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53699707 |
aaattagtttgtgggagtagcaacaccatatacgtgaaattagttttgcaaacatgtttagtaacaatacttgcatgcaaagttttgctgttactgttaa |
53699608 |
T |
|
| Q |
101 |
gaggacctttcaagtattcagtttgtttagaattaaaatgaacttagatttcatataacaaacatcttgggttttaattcaaatatatatggctaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53699607 |
gaggacctttcaagtattcagtttgtttagaattaaaatgaacttagattgcatataacaaacatcttgggttttaattcaaatatatatggctaaattt |
53699508 |
T |
|
| Q |
201 |
accactactattcttttct |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53699507 |
accactactattcttttct |
53699489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3682 times since January 2019
Visitors: 8709