View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_low_9 (Length: 376)
Name: NF4410_low_9
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410_low_9 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 17 - 368
Target Start/End: Complemental strand, 31010654 - 31010303
Alignment:
Q |
17 |
caagatctacctcaaaggatgatcaagttattatggtaacataacaatcaacccnnnnnnntacctcaactaatagctccatcaaaaaaccctcaacctt |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
T |
31010654 |
caagatctacctcaaaggatgatcaagttattatggtaacataacaatcaacccaaataaatacctcaactaatagctccatcaaaaaatcctcaacctt |
31010555 |
T |
|
Q |
117 |
ataaccagaccatggttttaaattacggtttcggtaaacattgcagttctgatgtcattgtagagacctcactatcctttatattgcagccgcaaacagt |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| | |
|
|
T |
31010554 |
ataaccagaccatggttttaaattacggtttcgataaacattgcagttgtgatgtcattgtagagacctcaatatcctttatattgcggccgcaaacaat |
31010455 |
T |
|
Q |
217 |
ttaaaaccatgatcaagagattttattgtttaatcaagcctgacggtaaaaaatatcaattaggcaagaccaagttcccaacactgcaataacaatccca |
316 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31010454 |
ttaaaaccatgattaagagattttattgtttaatcaagcctgagggtaaaaaatatccattaggcaagaccaagttcccaacactgcaataacaatccca |
31010355 |
T |
|
Q |
317 |
aacaccataattgctccatcaaaaaccaaacatttccaacccaattcatctc |
368 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31010354 |
aacaccataattgctccatcaaaaaccaaacatttccaacccaattcatctc |
31010303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3985 times since January 2019
Visitors: 8743