View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416-Insertion-5 (Length: 234)
Name: NF4416-Insertion-5
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4416-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 33804397 - 33804624
Alignment:
| Q |
7 |
aaatatagtataccctagacgacctgaattaaataaagcaggagtattagcagcatattcactcatacgaaattatggcaagtctttcaattttgaggaa |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804397 |
aaatatagtatacccgagacgacctgaattaaataaagcaggagtattagcagcatattcactcatacgaaattatggcaagtctttcaattttgaggaa |
33804496 |
T |
|
| Q |
107 |
agagttttcacctcatacgaatgaaactcgtattaagtgagatccacgttcatttaagtcaataattaagaaaatattactagtggaaaagaaaaataga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804497 |
agagttttcacctcatacgaatgaaactcgtattaagtgagatccacgttcatttaagtcaataattaagaaaatattactagtggaaaagaaaaataga |
33804596 |
T |
|
| Q |
207 |
tagattatgaatttgttttcctgaccct |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
33804597 |
tagagtatgaatttgttttcctgaccct |
33804624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2171 times since January 2019
Visitors: 8677