View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416-Insertion-6 (Length: 198)
Name: NF4416-Insertion-6
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4416-Insertion-6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 3e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 104 - 195
Target Start/End: Complemental strand, 10781982 - 10781891
Alignment:
| Q |
104 |
cattgttaaagtgcgggtacgaacattttgatgttcatatgacctgaggaccaacactaaaattattgtttgcgtggatatatttgttaccg |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| | ||||| | |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
10781982 |
cattgttaaagtgcgggtacgaatattttgatgttcatatggcatgaggccaaacactaaaattgttgtttgcatggatatatttgttaccg |
10781891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 10782074 - 10782009
Alignment:
| Q |
9 |
aatacaactatttgtcgttttttatgtgttgatttgaaatattctgaattatatttaaattcaatt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
10782074 |
aatacaactatttgtcgttttttatgtgttgatttgaaatattctggatcatatttaaattcaatt |
10782009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2688 times since January 2019
Visitors: 8577