View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_high_14 (Length: 346)
Name: NF4416_high_14
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4416_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 5 - 328
Target Start/End: Original strand, 49628923 - 49629238
Alignment:
| Q |
5 |
aagaaacgttgctgctcctaggttttaccactaactgtgattgattatttttcagatattgtccaattaatatgtgatcaattgtttccttaatttgcaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49628923 |
aagaaacgttgctgctcctaggttttaccactaactgtgattgatt---tttcagatattgtccaattaatatgtgatcaattgtttccttaatttgcaa |
49629019 |
T |
|
| Q |
105 |
attgctttctgatttatatcannnnnnnnatatattaacaagaacaagaatatctgatttctctttctacaattgttttgttttcgcagtttcacgttgt |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49629020 |
attgctttctgatttatatcattttttttatatattaacaagaacaagaatatctgatttctctttctacaattgttttgttttcgcagtttcaccttgt |
49629119 |
T |
|
| Q |
205 |
tgtcgtcgtcgttgtctgagtcatctcaatctcaaacgttatggcgaattctgatctctcattgcttttgccaagggttctcatcgtttctcgtcgtacc |
304 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49629120 |
tgttgtcg-----gtctgagtcatctcaatctcaaacgttatggcgaattctgatctctcattgcttttgccaagggttctcatcgtttctcgtcgtacc |
49629214 |
T |
|
| Q |
305 |
atccgaaagaacaaatttgttgat |
328 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49629215 |
atccgaaagaacaaatttgttgat |
49629238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4245 times since January 2019
Visitors: 8757