View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_high_23 (Length: 247)
Name: NF4416_high_23
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4416_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 161
Target Start/End: Complemental strand, 48208101 - 48207951
Alignment:
| Q |
12 |
atgaacaaaaataaatttaaagtagtaagatgaaacattgagtaagatatagtggttaaaattaagaattcaaaattgagtataa-aaaattgagcgtgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
48208101 |
atgaacaaaaataaatttaaagtagtaagatgaaacattgagtaagatatagtggttaaaattaagaattcaaaattgagtataaaaaaattgagtgtgt |
48208002 |
T |
|
| Q |
111 |
ctataaattattttttggaaaattctacgaggttcaacatgtgtgtcaaaa |
161 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48208001 |
ctataaattattttttgaaaaattctacgaggttcaacatgtgtgtcaaaa |
48207951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 47656579 - 47656529
Alignment:
| Q |
193 |
gcacgaaccgacacgaacaagctttcaatacacctgtgcgtacacgtctct |
243 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
47656579 |
gcacgaacccacacgaacaagctttcaacacatctgtgcttacacgtctct |
47656529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 243
Target Start/End: Original strand, 11441783 - 11441868
Alignment:
| Q |
158 |
aaaagagcgttgctatatcacacgatnnnnnnnccgcacgaaccgacacgaacaagctttcaatacacctgtgcgtacacgtctct |
243 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
11441783 |
aaaagagcgttgctatatcgcacgataaaaaaaccgcacgaacccacacgaacaagctttcaacacatctgtgtttacacgtctct |
11441868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2436 times since January 2019
Visitors: 8707