View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_high_25 (Length: 228)
Name: NF4416_high_25
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_high_25 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 41 - 218
Target Start/End: Original strand, 33712510 - 33712686
Alignment:
Q |
41 |
atatttagtgttaacaagatataagatgtatacttgaaaagagaaagnnnnnnnntgcatagatagtcttatattgaaggacaaaatttt-gttttttca |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
33712510 |
atatttagtgttaacaagatataagatgtatacttgaaaagagaga-aaaaaaaatgcatagatagtcttatattgaaggacaaaatttttgttttttca |
33712608 |
T |
|
Q |
140 |
aatgatcttacataggaaattaggaatagaatagagtttagtgtttatagcgaagttaaatatgatcatattgcctatg |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
T |
33712609 |
aatgatcttacataggaaattaggaatagaatagagtttagtgttta-agcgaagttaaatatgatcatattgtctatg |
33712686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 33712232 - 33712274
Alignment:
Q |
1 |
gacctcggtccatccaattgagagaaaagttgttggtgcaata |
43 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33712232 |
gacctcggtccatccaattgagagaaaagttgttggtgcaata |
33712274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2989 times since January 2019
Visitors: 8641