View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4416_high_27 (Length: 213)

Name: NF4416_high_27
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4416_high_27
NF4416_high_27
[»] chr8 (1 HSPs)
chr8 (18-207)||(42335968-42336157)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 42335968 - 42336157
Alignment:
18 agttaatacacaaattatggttgaggttgaataataatgaagatggtgatagtaacggcaatatagtaaggaattgaagtttgtttactttggtcaaaca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42335968 agttaatacacaaattatggttgaggttgaataataatgaagatggtgatagtaacggcaatatagtaaggaattgaagtttgtttactttggtcaaaca 42336067  T
118 tagagctgagtttgtgctttgagtagtggtctttggcatctctggtctaacgtccggaatcccaggactgatgtcttctgttctgtgctc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42336068 tagagctgagtttgtgctttgagtagtggtctttggcatctctggtctaacgtccggaatcccaggactgatgtcttctgttctgtgctc 42336157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3799 times since January 2019
Visitors: 8728