View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_low_23 (Length: 250)
Name: NF4416_low_23
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_low_23 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13446205 - 13445967
Alignment:
Q |
1 |
cctgcgaccttgtaggccctaaatcacaatgtacaaataaatggaaggttgtttctgattgattcacacacaccgaatacaatcttcggtcatatcctgc |
100 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
13446205 |
cctgtgaccttgtaggccctaaatcacaatgtagaaataaatggaaggttgtttctgattgattcacacac--cgaatacaatcttcggtcatatcctgc |
13446108 |
T |
|
Q |
101 |
aaaatgactccacaatgagctagagtacatctattttgaatcatgttattcaaaacctttgaaggcacctaccttttccaaatacgatgagacatctata |
200 |
Q |
|
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
T |
13446107 |
aaaatgactccacgatgagctagagcacatctattttgaatcatgttattcaaaacctttgaaggcacctaccttttccaaatacgatgaaacatccata |
13446008 |
T |
|
Q |
201 |
tctctagactacacatattgacttcaggtcagtatattctt |
241 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
13446007 |
tctctagactacccatattgacttcaggtcagtatattctt |
13445967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2291 times since January 2019
Visitors: 8690