View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_low_27 (Length: 245)
Name: NF4416_low_27
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_low_27 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 13446296 - 13446526
Alignment:
Q |
1 |
ttcgcgcctctttctgtttttctcctaccatttgtgtgttttgtgacgtcgtgtttctctgtctttgtttgttatatcttatcagccgattgttgtttta |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13446296 |
ttcgcgcctccttctgtttttctcctaccatttgtgtgttttgtgacgtcgtgtttctctgtctttgtttgttatatcttatcagccgattgttgtttta |
13446395 |
T |
|
Q |
101 |
ggagatttctttgctgtcattagatgcattcattaattggaaaagagaattacataaattccttgtccatttgaaacataaagtcaactttatccaaaca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13446396 |
ggagatttctttgctgtcattagatgcattcattaattggaaaagagaattacataaattccttgtccatttgaaacataaagtcaactttatccaaaca |
13446495 |
T |
|
Q |
201 |
catgaagtctatggtacattctcttcattct |
231 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
13446496 |
catgaagtctatggtacattctcttcattct |
13446526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2711 times since January 2019
Visitors: 8577