View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_low_30 (Length: 213)
Name: NF4416_low_30
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_low_30 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 830524 - 830343
Alignment:
Q |
17 |
caacaactactcccatggccagcaccgaagaatccctccgcaaatcccttcaatctcttccctctgctttttgctctgattctcgtgaagcatttcgtca |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||| |
|
|
T |
830524 |
caacaactactcccatggccagcaccgaagaatctctccgcaaatcccttcaatctcttctctctgcttccggctccgattctcgtgacgcatttcgtca |
830425 |
T |
|
Q |
117 |
atccgttgttaatacacttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggtttttatgat |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
830424 |
atccgttgttaatacacttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggtttttatgat |
830343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 198
Target Start/End: Complemental strand, 49235046 - 49234981
Alignment:
Q |
133 |
cttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggtttttatgat |
198 |
Q |
|
|
|||||||| ||| | ||||| ||||| |||||||| ||||| ||||||| ||||||||||||||| |
|
|
T |
49235046 |
cttgaacgccgtttgttttatattccttcgtttaagatttatcgcggtgttgctggtttttatgat |
49234981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 198
Target Start/End: Complemental strand, 941968 - 941864
Alignment:
Q |
94 |
gattctcgtgaagcatttcgtcaatccgttgttaatacacttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggttttt |
193 |
Q |
|
|
||||| |||||||||||||||||||| ||| ||||| |||||||| ||| | ||||| ||||| |||||||| ||||| | ||||| |||||||||| |
|
|
T |
941968 |
gattcgcgtgaagcatttcgtcaatctgttaacaatacgcttgaacgccgtttgttttatattccttcgtttaagatttatcgtggtgttgctggttttt |
941869 |
T |
|
Q |
194 |
atgat |
198 |
Q |
|
|
||||| |
|
|
T |
941868 |
atgat |
941864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 50861624 - 50861689
Alignment:
Q |
133 |
cttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggtttttatgat |
198 |
Q |
|
|
|||||||| ||| | ||||| |||||||||||||| ||||| ||||||| ||||||||| ||||| |
|
|
T |
50861624 |
cttgaacgccgtttgttttatattccgtcgtttaagatttatcgcggtgttgctggttttaatgat |
50861689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3689 times since January 2019
Visitors: 8709