View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_low_31 (Length: 213)
Name: NF4416_low_31
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_low_31 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 42335968 - 42336157
Alignment:
Q |
18 |
agttaatacacaaattatggttgaggttgaataataatgaagatggtgatagtaacggcaatatagtaaggaattgaagtttgtttactttggtcaaaca |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42335968 |
agttaatacacaaattatggttgaggttgaataataatgaagatggtgatagtaacggcaatatagtaaggaattgaagtttgtttactttggtcaaaca |
42336067 |
T |
|
Q |
118 |
tagagctgagtttgtgctttgagtagtggtctttggcatctctggtctaacgtccggaatcccaggactgatgtcttctgttctgtgctc |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42336068 |
tagagctgagtttgtgctttgagtagtggtctttggcatctctggtctaacgtccggaatcccaggactgatgtcttctgttctgtgctc |
42336157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4135 times since January 2019
Visitors: 8754