View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4416_low_8 (Length: 460)
Name: NF4416_low_8
Description: NF4416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4416_low_8 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 332; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 20 - 443
Target Start/End: Complemental strand, 33921364 - 33920941
Alignment:
Q |
20 |
tgatacaaattggatgaaaccagcaaccgggcgctacaaatgcaactctggcggaccattctgttcacatcaaaatcgccaaaacaattcggatttcacc |
119 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33921364 |
tgatacaaattggatgaaaccagcgaccgggcgctacaaatgcaactctggcggaccattctgttcacatcaaaatcgccaaaacaattcggatttcacc |
33921265 |
T |
|
Q |
120 |
aaatagaggaagccttgggccatcttcatccgctcacttgagttcatgacttgcatctgggacaagtggtcaagtggattacactacactaaaagatcaa |
219 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33921264 |
aaataggggaagccttgggccatcttcatccgctcacttgagttcatgacttgcatctgggacaagtggtcaagtggattacactacactaaaagatcaa |
33921165 |
T |
|
Q |
220 |
ttgatctttttaatagtgataagattgacgtcaaagaattcggatacattaatagcgagtgtgaacgnnnnnnnnnnnnccatttggaaaactcgtgctg |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||| ||||||||||||||||| || |
|
|
T |
33921164 |
ttgatctttttaatagtgataagattgacgtcaaagaattcggagacattaataggtagtgtggacgttttttcttttttcatttggaaaactcgtgttg |
33921065 |
T |
|
Q |
320 |
agtttattaagataaacaaatgatcggtagctcacgctccatcaaggatagctagatgtggcccacatctctagctagttctcaaattttcattgatgtc |
419 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
33921064 |
agtttattaagagaaacaaatgatcggtagctcacgctccatcaaggatagctagatgtggcccacatctctagctagttctcatattttcattgatgtt |
33920965 |
T |
|
Q |
420 |
ccaacatatactggatatgaacac |
443 |
Q |
|
|
||||||| ||||| || ||||||| |
|
|
T |
33920964 |
ccaacatgtactgaatttgaacac |
33920941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 33904411 - 33904334
Alignment:
Q |
19 |
ttgatacaaattggatgaaaccagcaaccgggcgctacaaatgcaactctggcggaccattctgttcacatcaaaatc |
96 |
Q |
|
|
||||||||||||||||||||||| |||| ||| |||||||||||||| || || |||||| |||||||||||||| |
|
|
T |
33904411 |
ttgatacaaattggatgaaaccaacaacggggtgctacaaatgcaacattgacgtgtcattctcttcacatcaaaatc |
33904334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2408 times since January 2019
Visitors: 8707