View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418-Insertion-11 (Length: 96)
Name: NF4418-Insertion-11
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4418-Insertion-11 |
| |
|
[»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 55 - 96
Target Start/End: Original strand, 28204149 - 28204190
Alignment:
Q |
55 |
tcatctttctctctctttgtgtctgttttgttgtgaattgga |
96 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
28204149 |
tcatccttctctctctttgtgtctgttttgttgtgaattgga |
28204190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1627 times since January 2019
Visitors: 8581