View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418-Insertion-8 (Length: 134)
Name: NF4418-Insertion-8
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4418-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 4939668 - 4939793
Alignment:
| Q |
8 |
taaacgtcacacttatctattactttattgttttctaaaatctctggggccacgtaaccatatgaacctatatatgagagcaagtatcaattatttaagt |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4939668 |
taaacgtcacacttatctgttactttattgttttctaaaatctctggggccacgtaaccatatgaacctatatatgagagcaagtatcaattatttaagt |
4939767 |
T |
|
| Q |
108 |
caatatacaacttagccctcacctca |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4939768 |
caatatacaacttagccctcacctca |
4939793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 327 times since January 2019
Visitors: 8104