View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_high_30 (Length: 250)
Name: NF4418_high_30
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4418_high_30 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 115 - 250
Target Start/End: Complemental strand, 26877677 - 26877549
Alignment:
Q |
115 |
ttatttatatgttatatgaaagtctatgcccaacaattttaaaaaataactagaattagannnnnnnnnnnnnnnnngaataagctaaattagtaccact |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26877677 |
ttatttatatgttatatgaaagtctatgcccagcaattttcaaaaataactagaattag-------ttttttttttttaataagctaaattagtaccact |
26877585 |
T |
|
Q |
215 |
cttagaccacaagaagtcatgaaattgtgtcaccta |
250 |
Q |
|
|
|||||||||||| ||||||||||| ||||||||||| |
|
|
T |
26877584 |
cttagaccacaacaagtcatgaaagtgtgtcaccta |
26877549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1031 times since January 2019
Visitors: 8372