View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_high_36 (Length: 231)
Name: NF4418_high_36
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4418_high_36 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 31627142 - 31627353
Alignment:
Q |
1 |
tctgagaaggatagtgtttggaattagaaagtagaatgagaatagaatgattgggttgagtattatcgggggaatattaaagctgtcttttcttctcttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31627142 |
tctgagaaggatagtgtttggaattagaaagtagaatgagaatagaatgattgggttgagtattatcgggggaatattaaagctgtcttttcttctcttg |
31627241 |
T |
|
Q |
101 |
cccctatctcctactctagtcctactactttctacatactactaggagtacatcacataatggaaggaattatatttaagctatgtttggtgagaaacat |
200 |
Q |
|
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
31627242 |
cccctatctcctactctaatcctactacttactacatactactaggagtacatcacataatggaaggaattatatttaggctatgtttggcgagaaacat |
31627341 |
T |
|
Q |
201 |
ttttcagcttat |
212 |
Q |
|
|
|||||||||||| |
|
|
T |
31627342 |
ttttcagcttat |
31627353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1786 times since January 2019
Visitors: 8634