View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_low_32 (Length: 258)
Name: NF4418_low_32
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4418_low_32 |
| |
|
[»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 125 - 258
Target Start/End: Original strand, 24528574 - 24528709
Alignment:
Q |
125 |
tatacaatttgtgcagtcagtgttagcatgaaaaaatacaatgcaactagatgaggtggtgagatccttggagaagagttaacaaatgatgggtgatcat |
224 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
24528574 |
tatacaatttgtgcagtcactgttagcatgaaaaaatacaatgcaactagacgaggtggtgagatccttggagaatagtcaacaaatgatgggtgatcat |
24528673 |
T |
|
Q |
225 |
aaatcttc-aaaagaaaat-aaatactaggaactaa |
258 |
Q |
|
|
|||||||| |||||||||| ||||||||| |||||| |
|
|
T |
24528674 |
aaatcttcaaaaagaaaatcaaatactagtaactaa |
24528709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 24521067 - 24521172
Alignment:
Q |
18 |
catattagtaagtttaatgagttggtatctagacttatgaatgcaagggacaatatcaaagatgaagagtaaatgttacttttgttagcttcactaccat |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
T |
24521067 |
catattagtaagtttaatgagttggtatctagacttatgaatgcaagggacaatatcaaaggtgaagagtaaatgttacttttattagcttcactaccat |
24521166 |
T |
|
Q |
118 |
aatctt |
123 |
Q |
|
|
|||||| |
|
|
T |
24521167 |
aatctt |
24521172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 931 times since January 2019
Visitors: 8333