View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_low_33 (Length: 253)
Name: NF4418_low_33
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4418_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 25 - 202
Target Start/End: Original strand, 2045024 - 2045201
Alignment:
| Q |
25 |
aaaacagttcagttaataaccaatccttttcatatggttcagttatgaacttttacaaacggtttagttcaataacaggtcagttcagcagttcggttca |
124 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2045024 |
aaaacagttcagctaataaccaatccttttcatatggttcagttatgaacttttacaaacggttcagttcaataacaggtcagttcagcagttcggttca |
2045123 |
T |
|
| Q |
125 |
actttttggttattttgaacacccctctatgtaccattagatctatcataggtggttggtgcataatgtttgtgaata |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2045124 |
attttttggttattttgaacacccctctatgtaccattagatctatcataggtggttggtgcataatgtttgtgaata |
2045201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 36 - 102
Target Start/End: Original strand, 32375677 - 32375744
Alignment:
| Q |
36 |
gttaataaccaatccttttcatatggttcagttatgaacttttacaaa-cggtttagttcaataacag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||| ||||| |||||||||||| |
|
|
| T |
32375677 |
gttaataaccaatccttttcatatggttcagttctgaactcttacaaattggtttggttcaataacag |
32375744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 25 - 102
Target Start/End: Complemental strand, 53679348 - 53679271
Alignment:
| Q |
25 |
aaaacagttcagttaataaccaatccttttcatatggttcagttatgaacttttacaaa-cggtttagttcaataacag |
102 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| | ||||| |||| ||| | ||||||||||||||||| |
|
|
| T |
53679348 |
aaaacagttcagttagtaaccagaccttttcatatggttcag-tctgaacatttataaaccagtttagttcaataacag |
53679271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1819 times since January 2019
Visitors: 8634