View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_low_34 (Length: 250)
Name: NF4418_low_34
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4418_low_34 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 115 - 250
Target Start/End: Complemental strand, 26877677 - 26877549
Alignment:
| Q |
115 |
ttatttatatgttatatgaaagtctatgcccaacaattttaaaaaataactagaattagannnnnnnnnnnnnnnnngaataagctaaattagtaccact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26877677 |
ttatttatatgttatatgaaagtctatgcccagcaattttcaaaaataactagaattag-------ttttttttttttaataagctaaattagtaccact |
26877585 |
T |
|
| Q |
215 |
cttagaccacaagaagtcatgaaattgtgtcaccta |
250 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
26877584 |
cttagaccacaacaagtcatgaaagtgtgtcaccta |
26877549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5333 times since January 2019
Visitors: 7845