View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4418_low_38 (Length: 238)
Name: NF4418_low_38
Description: NF4418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4418_low_38 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29040904 - 29040683
Alignment:
Q |
1 |
ttcagcatatttattcctagtggtaagtagnnnnnnn-cttcttttctatgatgcatagcagaatgtggtctttgtgtctatgctttgctcatttttatt |
99 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29040904 |
ttcagcatatttattcctagtggtaagtagttttttttcttcttttctatgatgcatagcagaatgtggtctttgtgtctatgctttgctcatttttatt |
29040805 |
T |
|
Q |
100 |
tggctaaagggaacgtgacttgaaaaagcaatttcaagcaaaagcgtcttatttaaagagatttgataatgattttaagattatgaaaacacaaaagcat |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29040804 |
tggctaaagggaacgtgacttgaaaaagcaatttcaagcaaaagcgtcttatttaaagagatttgataatgattttaagattatgaaaacacaaaagcat |
29040705 |
T |
|
Q |
200 |
ttcttcctgttgaggtgttgga |
221 |
Q |
|
|
|||||| ||||||||||||||| |
|
|
T |
29040704 |
ttcttcttgttgaggtgttgga |
29040683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1628 times since January 2019
Visitors: 8581