View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539-Insertion-10 (Length: 94)
Name: NF4539-Insertion-10
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4539-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 4e-35; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 1117760 - 1117682
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattgacaaataccc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1117760 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattggcaaataccc |
1117682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 1105576 - 1105491
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattgacaaatacccttttaca |
93 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| | |||||||||||||||||| ||||||||||||| ||||||| ||||||| |
|
|
| T |
1105576 |
tcttctcatttggatgtaacaaacagaaaattgttttatcatttcttagtttttaacacttatatattggtaaatacctttttaca |
1105491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 1128241 - 1128156
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattgacaaatacccttttaca |
93 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| |||| |||| ||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
1128241 |
tcttctcctttagatgtaacaaaaagaaaattgtttgattattttctagtttttagcacttatatattggcaaatacctttttaca |
1128156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 1096830 - 1096754
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattgacaaatac |
84 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |||||||||| ||| ||||||||||||||||||| ||||||| |
|
|
| T |
1096830 |
tcttctcctttaaatgtaataaatagaaaattgtttgatcatttcctaggttttagcacttatatattggcaaatac |
1096754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 1086605 - 1086534
Alignment:
| Q |
22 |
tgtaacaaatagaaaattgtat-gatcatttcttagtttttagcacttatatattgacaaatacccttttac |
92 |
Q |
| |
|
|||||||||| ||||| ||| | ||||||||| ||||||| |||||||||||| || |||||||| |||||| |
|
|
| T |
1086605 |
tgtaacaaatcgaaaactgttttgatcatttcctagttttcagcacttatatactggcaaatacctttttac |
1086534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 1102406 - 1102351
Alignment:
| Q |
20 |
gatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattg |
76 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| || ||| |||||||| |||||||||| |
|
|
| T |
1102406 |
gatgtaacaaattgaaaattgtttgatcatatcctag-ttttagcatttatatattg |
1102351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 8116844 - 8116762
Alignment:
| Q |
12 |
ctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattgacaaatacccttttacag |
94 |
Q |
| |
|
|||||||| || |||| || || ||||||| |||||||||| || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8116844 |
ctcctttgcatataacgaaaagtaaattgtttgatcatttcctaatttttagcacttatatattgacaaatacatttttacag |
8116762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 26584354 - 26584286
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcacttatatattg |
76 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||| ||| || || |||||| |||||||||||||||| |
|
|
| T |
26584354 |
tcttctcttttgcatgtaacaaatagataattgtttgaccactttatagtttgtagcacttatatattg |
26584286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 26570896 - 26570836
Alignment:
| Q |
8 |
tcttctcctttggatgtaacaaatagaaaattgtatgatcatttcttagtttttagcactt |
68 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||| || || ||| |||||||||||| |
|
|
| T |
26570896 |
tcttctcctttgtgtgtaacaaatagataattgtttgaccactttttattttttagcactt |
26570836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5494 times since January 2019
Visitors: 7910