View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539-Insertion-6 (Length: 286)
Name: NF4539-Insertion-6
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4539-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 286
Target Start/End: Complemental strand, 51916797 - 51916516
Alignment:
| Q |
8 |
gaagtcaaacattgatgagcgtcatccgtaacgaaccatccaccactcccaatggcttctctttgatgcctataaaaaccctccttcaaaacaatgcaag |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51916797 |
gaagtcaaacattgatgagcgtcgtccgtaacgaaccatccaccactcccaacgacttctctttgatgcctataaaaaccctccttcaaaacaatgcaag |
51916698 |
T |
|
| Q |
108 |
atattcaatctttttacctaatatatcttcctctcttgctttttaactgacttgaacatcatagtactttgcaaaaaacaccctccaacatccatcccga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51916697 |
atattcaatctttttacctaatatatctttctctcttgctttttaactcacttgaacatcatagtactttgcaaaaaacaccctccgacatccatcccga |
51916598 |
T |
|
| Q |
208 |
tg---gttgttcaagttattattatcaatcttgatcgggtaagatcaaatattaaaagacaattcattcaattcccaccgag |
286 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51916597 |
tggacgttgttcaagttattattatcaatcttgatcgggtaagatcaaatattaaaagacaattcattcaattcccaccgag |
51916516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1355 times since January 2019
Visitors: 8475