View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539-Insertion-7 (Length: 160)
Name: NF4539-Insertion-7
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4539-Insertion-7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 8 - 160
Target Start/End: Complemental strand, 36106 - 35954
Alignment:
| Q |
8 |
aaccattctttgttgtcccattcaattgaacttcactagtggtgtcttgttaattcattctcaatttcatctctcatttgctttgtctttgtataagata |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36106 |
aaccattctttgttgtctcattcaattgaacttcactagtggtgtcttgttaattcattctcaatttcatctctcatttgctttgtctttgtataagata |
36007 |
T |
|
| Q |
108 |
tggtttcctttctttcaggtttctcttgaaattcaattggattcataatatga |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36006 |
tggtttcctttctttcaggtttctcttgaaattcaattggattcataatatga |
35954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1360 times since January 2019
Visitors: 8475