View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539-Insertion-8 (Length: 149)
Name: NF4539-Insertion-8
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4539-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 1e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 38689110 - 38689051
Alignment:
| Q |
8 |
aagctcaggaacctgttcaatgtttcaacagaacttacattgacacatctatgattactt |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38689110 |
aagctcaggaagctgttcaatgtttcaacagaacttacattgacacatctatgattactt |
38689051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 92 - 143
Target Start/End: Complemental strand, 38689056 - 38689005
Alignment:
| Q |
92 |
ttactttcatgtaatgatttaatattttattactcaacttcaaaccactcta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38689056 |
ttactttcatgtaatgatttaatattttattactcaaactcaaaccactcta |
38689005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 656 times since January 2019
Visitors: 8213