View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539_low_10 (Length: 262)
Name: NF4539_low_10
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4539_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 245
Target Start/End: Complemental strand, 17471008 - 17470775
Alignment:
| Q |
12 |
agagagaagaaccgaagattattgtatctttgttaacgaagggagctcaaccttctgaactcactatggatggcagaaaagctcttcagatttcaaagcg |
111 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17471008 |
agagaaaagaaccgaaaattattgtatctttgttaacgaagggagctcaaccttctgaactcactatggatggcagaaaagctcttcagatttcaaaacg |
17470909 |
T |
|
| Q |
112 |
ttgtacgaaagctgtggattattataaatctactgaggaagcaaaggtttcttcgaatgatcgattatgtatagagatattagagcaagctgagataagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||||||||| ||||||||||||| |||| |
|
|
| T |
17470908 |
ttgtacgaaagctgtggattattataaatctactgaggaaggaaaagtttcttcgaatgatcgattgtgcatagagatattggagcaagctgagagaagg |
17470809 |
T |
|
| Q |
212 |
gagcctttgcatggggaggcatctctttctcttg |
245 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
17470808 |
gagcctttacatggggaggcatctctttctcttg |
17470775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5497 times since January 2019
Visitors: 7911