View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4539_low_9 (Length: 267)
Name: NF4539_low_9
Description: NF4539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4539_low_9 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 45793677 - 45793425
Alignment:
Q |
1 |
actcagagcacataatatactatactcctaaattctaaattatatccccaaacgcataccaatagtcagttaatataccaatcaaatctccaactctgaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
45793677 |
actcagagcacataatatactatactcctaaattctaaattatatccccaaacgcataccaatagtcagttaatataccaaccaaatctccaactctgaa |
45793578 |
T |
|
Q |
101 |
aaacatggcagccaagactatgaaaaaatggcaatctagtactctaatcggcttagctttagatttgttaagaaaaataattgaaatttaacatttaaca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45793577 |
aaacatggcagccaagactatgaaaaaatggcaatctagtactctaatcggcttagctttagatttgttaagaaaaataattgaaatttaacatttaaca |
45793478 |
T |
|
Q |
201 |
gttaaagccttttaccttcccaattactctctcattattagtccaaaaatttg |
253 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
45793477 |
gttaaagccttttaccttccgaattactctctcattattagtccaaaaatttg |
45793425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 641 times since January 2019
Visitors: 8213