View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543-Insertion-10 (Length: 85)
Name: NF4543-Insertion-10
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4543-Insertion-10 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 14146864 - 14146788
Alignment:
Q |
8 |
attggttcaaactcatttgaattatggttaggtttggtcgaagttaaatcggttgaaccctgcatatagttgtttca |
84 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14146864 |
attggttcaaactcatttgaattatggttaggtttggtcgaagttaaatcggttgaaccctgcatatagttgtttca |
14146788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3362 times since January 2019
Visitors: 8687