View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543-Insertion-6 (Length: 310)
Name: NF4543-Insertion-6
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543-Insertion-6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 7 - 310
Target Start/End: Original strand, 4686610 - 4686913
Alignment:
| Q |
7 |
acaatttgcaataaatggtcaatactttgactcggtgcaagaagaacaaggcaagttcattccggaaattgatcatatggtatctaccaattatccacca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686610 |
acaatttgcaataaatggtcaatactttgactcggtgcaagaagaacaaggcaagttcattccagaaattgatcatatggtatctaccaattatccacca |
4686709 |
T |
|
| Q |
107 |
agatttgatgggttggaattcttttatggtgaagaagacttgaatattgatcataataagatacaaggttctagcactaattggagtgaagctaccactt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686710 |
agatttgatgggttggaattcttttatggtgaagaagacttgaatattgatcataataagatacaaggttctagcactaattggagtgaagctaccactt |
4686809 |
T |
|
| Q |
207 |
caagttatcatcatcctcttgattcgaaataccaaggttaagttgtgatttgtgaggtaagattagtggttttaaattgcggttatgttgtgaaccttca |
306 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686810 |
caacttatcatcatcctcttgattcaaaataccaaggttaagttgtgatttgtgaggtaagattagtggttttaaattgcggttatgttgtgaaccttca |
4686909 |
T |
|
| Q |
307 |
tatt |
310 |
Q |
| |
|
|||| |
|
|
| T |
4686910 |
tatt |
4686913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2128 times since January 2019
Visitors: 8677