View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543-Insertion-8 (Length: 194)
Name: NF4543-Insertion-8
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 32694469 - 32694283
Alignment:
| Q |
8 |
aaatgttaccggcgggaaacataacaacaattttccggcaccggagaagaagatctcgctaaaatggaaactcagaagagtcaatcaaagcttacaagaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32694469 |
aaatgttaccggcgggaaacataacaacaattttccggcaccggagaagaagatctcgctaaaatggaaactcagaagagtcaatcaaagcttacaagaa |
32694370 |
T |
|
| Q |
108 |
cacaatcttcacttctcaatctcacttcttcaccaacaattcgatcttcatcgattcaaagcctttcttccatcaacgattgttact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32694369 |
cacaatcttcacttctcaatctcacttcttcaccaacaattcgatcttcatcgattcaaagcctttcttccatcaacgattgttact |
32694283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 75 - 194
Target Start/End: Complemental strand, 43907113 - 43907007
Alignment:
| Q |
75 |
aaactcagaagagtcaatcaaagcttacaagaacacaatcttcacttctcaatctcacttcttcaccaacaattcgatcttcatcgattcaaagcctttc |
174 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||| |||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
43907113 |
aaactcataagagtcaatcaaagcttacaagaacacaatgttcatttct-------------tcaccaacgattcgatcttcatcgattcaaagtctttc |
43907027 |
T |
|
| Q |
175 |
ttccatcaacgattgttact |
194 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43907026 |
ttccatcaacgattgttact |
43907007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3690 times since January 2019
Visitors: 8709