View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543-Insertion-9 (Length: 127)
Name: NF4543-Insertion-9
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543-Insertion-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 33791342 - 33791461
Alignment:
| Q |
8 |
caatggaccctaatttaaggaaaacgttggttcaatggtgtggtgttgaaggtaaggatccattggtgtttttggatcaaaacacttcttttgtgtttga |
107 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33791342 |
caatggaccctaatttaagaaaaaggttggttcaatggtgtggtgttgaaggtaaggatccattagtgtttttggatcaaaacacttcttttgtttttga |
33791441 |
T |
|
| Q |
108 |
tcatcaattttataatcaga |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33791442 |
tcatcaattttataatcaga |
33791461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3371 times since January 2019
Visitors: 8687