View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_high_15 (Length: 252)
Name: NF4543_high_15
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4543_high_15 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 55452918 - 55453165
Alignment:
Q |
1 |
cagtgcattcggtattcaatagtcattgtgttgaaactggcacaactgacaaagttattcttactatgtggttcatacttcctgccaaaacaatttcacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55452918 |
cagtgcattcggtattcaatagtcattgtgttgaaactggcacaactgacaaagttattcttactatgtggttcatacttcctgccaaaacaatttcacc |
55453017 |
T |
|
Q |
101 |
aaagctaaaatcttcacttggttgagtgacattgatttgtatttccagatcctgagttccttgtggagttatggtnnnnnnngttggatacaggttcact |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
T |
55453018 |
aaagctaaaatcttcacttggttgagtgacattgatttgtatttccagatcctgagttccttgtggagttatggtaaaaaaagttggatacaggttaact |
55453117 |
T |
|
Q |
201 |
gcagttctattaggagctcgaacaccgcataagtatgtctctgtgctg |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55453118 |
gcagttctattaggagctcgaacaccgcataagtatgtctctgtgctg |
55453165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 43 - 248
Target Start/End: Complemental strand, 55705363 - 55705157
Alignment:
Q |
43 |
caactgacaaagttattcttactatgtggttcatacttcctgccaaaacaatttcaccaaagctaaaatcttcacttggttgagtgacattgatttgtat |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55705363 |
caactgacaaagttattcttactatgtggttcatacttcctgccaaaacaatttcaccaaagctaaaatcttcacttggttgagtgacattgatttgtat |
55705264 |
T |
|
Q |
143 |
ttccagatcctgagttccttgtggagttatggt-nnnnnnngttggatacaggttcactgcagttctattaggagctcgaacaccgcataagtatgtctc |
241 |
Q |
|
|
|||||||||| | |||| |||||||||||||| |||||||||| ||| |||||||||| |||||||||| |||||||||| ||||||||||| |
|
|
T |
55705263 |
ttccagatcccgtgttctatgtggagttatggtaaaaaaaagttggatacaagttaactgcagttccattaggagctagaacaccgcacaagtatgtctc |
55705164 |
T |
|
Q |
242 |
tgtgctg |
248 |
Q |
|
|
||||||| |
|
|
T |
55705163 |
tgtgctg |
55705157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4260 times since January 2019
Visitors: 8757