View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_high_16 (Length: 245)
Name: NF4543_high_16
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4543_high_16 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 116 - 235
Target Start/End: Original strand, 15772715 - 15772834
Alignment:
Q |
116 |
caaatcattcacattgacaataagagtttaacgtaatcggtcaacttcttaccaattaagtcaattttcattggttaaacaaaaatttcttatcacacca |
215 |
Q |
|
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15772715 |
caaatcattcatattgacaacaagagtttaacgtaatcggtcaacttcttaccaactaagtcaattttcattggttaaacaaaaatttcttatcacacca |
15772814 |
T |
|
Q |
216 |
tgcttctcaaatgtcctttg |
235 |
Q |
|
|
||||||||| |||| ||||| |
|
|
T |
15772815 |
tgcttctcacatgttctttg |
15772834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3512 times since January 2019
Visitors: 8698