View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4543_high_23 (Length: 223)

Name: NF4543_high_23
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4543_high_23
NF4543_high_23
[»] scaffold0067 (1 HSPs)
scaffold0067 (19-103)||(39598-39682)


Alignment Details
Target: scaffold0067 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 39682 - 39598
Alignment:
19 tgtgcaccgtaactcaaatgagttggtacttgttaaacattcagggatgaaaatgactattcgtccatgtttttaggagtagata 103  Q
    ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
39682 tgtgcaccgtacctcaaatgagttggtactcgttaaacattcagggatgaaaatgactatttgtccatgtttttaggagtagata 39598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3653 times since January 2019
Visitors: 8709