View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_high_3 (Length: 394)
Name: NF4543_high_3
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 2551460 - 2551078
Alignment:
| Q |
1 |
tacattattcattgatttcatttgagttgacataaacttcatgattatttatgaatctcaagtagcttctgatgatatttgaacaattatccatgaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551460 |
tacattattcattgatttcatttgagttgacataaacttcatgattatttatgaatctcaagttgcttctgatgatatttgaacaattatccatgaggaa |
2551361 |
T |
|
| Q |
101 |
aacgtgagaccgtaatcgtccaacttttttaaataaaatatatcttttttgtcattgaaattgaattaatcaacttggaaatatagggtgacaacattat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551360 |
accgtgagaccgtaatcgtccaacttttttaaataaaatatatcttttttgtcattgaaattgaattaatcaacttggaaatatagggtgacaacattat |
2551261 |
T |
|
| Q |
201 |
attataaaataatcaaataaactatgttatgtgattctttcacaactc--agaagtttattaacagatttatcaagcaaacaatttgaattcttcaagcc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
2551260 |
attataaaataatcaaataaactatgttatgtgattctttcacaactcagagaagtttattaacagatttatcaagcaagcaatttgaattcttcaaggc |
2551161 |
T |
|
| Q |
299 |
attgtcttctttttatgattaggtcatgaaaataaaattataaatttatacagcaatcacagctcttgttgatgtccacgttc |
381 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2551160 |
attgtcttctttgattaattatttcatgaaaataaaattataaatttatacagcaataacagctcttgttgatgtccacgttc |
2551078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3942 times since January 2019
Visitors: 8743