View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_high_5 (Length: 368)
Name: NF4543_high_5
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 12 - 349
Target Start/End: Complemental strand, 52851256 - 52850920
Alignment:
| Q |
12 |
atgaatagatgatgaagatgaatataggtaggaagcatttactttaatttaatcactatcatcttacannnnnnnncaatgatagaacgaaacctagaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52851256 |
atgaatagatgatgaagatgaatataggtaggaagcatttactttaatttaatcactatcatcttacatttcttttcaatgatagaacgaaacctagaag |
52851157 |
T |
|
| Q |
112 |
ataaaagtagaagtaaactgcaacactaatttaaccgacctgagtttgaattgctgaaatgtcccctttttcccccctcaagctagctctattaaagggt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52851156 |
ataaaagtagaagtaaactgcaacactaatttaaccgacctgaatttaaattgctgaaatgtcccctttttccccc-tcaagctagctctattaaagggt |
52851058 |
T |
|
| Q |
212 |
agacattgtgtccttccaactaagggattttatgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcggccgtgttaataaaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52851057 |
agacattgtgtccttccaactaagggattttatgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcacccgtgttaataaaa |
52850958 |
T |
|
| Q |
312 |
ccaaccaactttgcaacaagcgcagcactttctcttat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850957 |
ccaaccaactttgcaacaagcgcagcactttctcttat |
52850920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2316 times since January 2019
Visitors: 8690