View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_19 (Length: 279)
Name: NF4543_low_19
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4543_low_19 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 27189923 - 27189664
Alignment:
Q |
1 |
ggctactgcgccagcaataacaacggcggatgtagcgagacggagtggtggcgatagtttgtcaacgacgttttcgattccggtgaggtctttgggcgga |
100 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
27189923 |
ggctactgcgccggcaataacaacggcggatgtagcgagacggagtggtggtgatagtttgtcgacgacgttttcgattccggtgaggtctttgggcgga |
27189824 |
T |
|
Q |
101 |
ggaacggaggaggatgatgaagagcgtgggagtgagagtttgaaacagtgtcgtttggtggatgaagagagtgggaaagggaagggtaatggaatgagag |
200 |
Q |
|
|
|||||||||||||| ||||| ||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
27189823 |
ggaacggaggaggaggatgatgagcgagggagtgggagtttgaaacggtgtcgtttggtggatgaagagagtgggaaagggaagggtgatggaatgagag |
27189724 |
T |
|
Q |
201 |
aagaaggtgtgagagttgacgaaggattcattgttttggtttgatttgaaatgagaaaag |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27189723 |
aagaaggtgtgagagttgacgaaggattcattgttttggtttgatttgaaatgagaaaag |
27189664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4145 times since January 2019
Visitors: 8754