View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4543_low_22 (Length: 245)

Name: NF4543_low_22
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4543_low_22
NF4543_low_22
[»] chr1 (1 HSPs)
chr1 (116-235)||(15772715-15772834)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 116 - 235
Target Start/End: Original strand, 15772715 - 15772834
Alignment:
116 caaatcattcacattgacaataagagtttaacgtaatcggtcaacttcttaccaattaagtcaattttcattggttaaacaaaaatttcttatcacacca 215  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
15772715 caaatcattcatattgacaacaagagtttaacgtaatcggtcaacttcttaccaactaagtcaattttcattggttaaacaaaaatttcttatcacacca 15772814  T
216 tgcttctcaaatgtcctttg 235  Q
    ||||||||| |||| |||||    
15772815 tgcttctcacatgttctttg 15772834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3242 times since January 2019
Visitors: 8679