View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_29 (Length: 237)
Name: NF4543_low_29
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 23 - 226
Target Start/End: Complemental strand, 39550036 - 39549821
Alignment:
| Q |
23 |
cacttataaatcagaaatggcatattgatcaagaaagataacgagtatattatcggaatatcttcccataga------------tattatttccaagatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
39550036 |
cacttataaatcagaaatggcatattgatcaagaaagataacaagtatattatcggaatatcttctcatagaaaatgccatggatattatttccaagatc |
39549937 |
T |
|
| Q |
111 |
atatataattcgtacgtatcaacaatgtacaacttatattcttttcaaaattgatccaactcgtgttaattagatggaatattgttgattcccttcttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39549936 |
atatataattcgtacgtatcaacaatgtacaacttatattcttttcaaaattgatccaactcgtgttaattagatggaatatcgttgattcccttcttta |
39549837 |
T |
|
| Q |
211 |
ttttgcacattttcat |
226 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
39549836 |
ttgtgcacattttcat |
39549821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3856 times since January 2019
Visitors: 8728